Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig673
Contig Information
Length 774 bp
Tissue Shoot with ABA treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whva15f13    rwhva15f13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein LOC100194356 [Zea mays] >gi|194695608|gb|ACF81888.1| unknown [Zea mays] >gi|195649741|gb|ACG44338.1| transcription factor BTF3 [Zea mays]
Score 625
Evalue 3.1319e-63
Total Hit Count 339
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig673
TGGTCTCTCCCGCTCCTATCCTCTCCTCCCCCCCTTGCGCCGCCGCCGGCGCCCTCGCCGCGGCTTCCGCTCCTCCCCCAGCCAAGATGAATGTTGAAAA
GCTCAAGAAGATGGCAGGTGCCGTGCGCACCGGGGGGAAGGGTAGCATGCGCAGGAAGAAGAAGGCTGTACACAAGACCACAACTACAGATGACAAAAGG
CTCCAGAGTACCCTGAAAAGAGTAGGAGTGAACACCATTCCTGGTATCGAAGAGGTCAACATCTTTAAGGATGATGTGGTTATTCAGTTTCTGAATCCTA
AAGTGCAAGCTTCAATTGGTGCTAATACATGGGTAGTCAGTGGAACACCACAGACAAAGAAACTGCAAGATCTGCTGCCATCAATTATCAATCAACTTGG
TCCTGACAACTTGGACAACCTGCGGAGGCTTGCAGAGCAATTCCAAAAGCAGGTCCCTGGTGGTGCTGCTGGCATCGAGGCTGGTGCCAGTGCAGGTGCA
GCTCAGGCTGACGACGATGATGATGTTCCTGAGCTTGTCCCTGGAGACATTTGAAGAGGCCGCTGAAGAGAAAAAGGCAGAGTCGTGATTTTGATGCATG
TTTACTGTTGTGAAGGGTTATAAGTTAAGCGGCGCCATTAGAGACCTCCCCTTTCAAGAACTCTGACCTACCTTATTTGTGCCAGTGGACCGGTTTTGTC
ATGTACGCGAGTTTCGTCTGATATGTTGGTGGAATTTTGCATCAAATTACATGCCTCTTTTGGTAAAAAAAAAA
page-top