Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig671
Contig Information
Length 1224 bp
Tissue Shoot with ABA treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whva15f21    rwhva15f21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative kinase [Oryza sativa (japonica cultivar-group)] >gi|31433008|gb|AAP54572.1| CDPK-related protein kinase, putative, expressed [Oryza sativa (japonica cultivar-group)]
Score 1187
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig671
AGAATCTTGTCCAGAGGTGGGAGGTACACTGAGGATGATGCTAAAGTTATCATCAAACAGATATTAAGTGTAGTTGCTTTCTGCCATCTTCAGGGTGTTG
TTCATCGTGATCTTAAGCCAGAGAATTTCCTATTCAGTACTAGAGATGAACATTCTCCTATGAAGCTCATCGATTTTGGCCTCTCTGATTTTATAAGGCC
AGATGAAAGGCTGAATGACATTGTTGGTAGTGCATACTATGTTGCTCCAGAAGTCCTACATAGGTCATATAGCACAGAAGCAGACATGTGGAGCGTAGGT
GTTATCACTTATATCTTGCTGTGTGGTAGCAGACCATTCTGGGCACGCACTGAATCAGGAATTTTCCGCTCTGTGCTGAGAGCTGATCCTAATTTTGACG
ATTCACCATGGGCATCAATATCTCCTGAAGCTAAAGACTTTGTCAAAAGACTTCTTAACAAGGATTACAGAAAAAGAATGACTGCTGCACAGGCACTCTC
TCACCCCTGGTTGCGAGATGAGTGCTGCCCAGTCCCTCTGGATATGCTAGTTTTTAAGCTGGTTAAGGCGCATCTTCGTTCCACACCTTTCAAACGGGCA
GCATTAAAGGCTCTGTCTAGAGCAATAACAGAAGATGAGCTTATCTATGCCAGAGCACAGTACAACTTATTACAACCAAGTAGTCAAGATGGTCGAATAT
GTATTGAGAACTTCAGGGATGGCTCTTCTACAAAACTCCACTGACGCTATGAAAGAATCTAGAACTCTTGATATCTTAAGTGCGTTGGAGCCGCTTGCAT
ATAGGAGAATGGACTTTGAGGAGTTCCGTGCGGCGACTATCAGCCCTTACCAACTTGAAGCTTCGTCTATGTGGGACGAAATAGCGAGCACCGCATTTGA
GTGCTTTGAGCAGGAAGGCAACCGTGTTATCACAATTGAGGAGCTAGCTCAGGAGATGAATCTTTCTTCTGCGGCGTATTCTATCGTCCGCGACTGGATT
AGGCCATCAGATGGGAAGCTTAGCTTTATAGGCTACACCAAATTTTTGCATGGATTGACTATGCGAAGCAGCAACGCGAGGCGCCATCACTGATCTGTTT
CGCCTCAGCTGCTTAGATTTCTTTGATTCATGGGGAGTTTGATGGATGTTGGTGTTTTATCTGTGTTTTTGGCGGTTTAGCGTTTGTAGAGAAAAAAGAA
GAAAGAAACAGAAAGTGGGAGTCA
page-top