Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig670
Contig Information
Length 775 bp
Tissue Shoot with ABA treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whva15f22    rwhva15f22   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit 1,2-dihydroxy-3-keto-5-methylthiopentene dioxygenase 4 [Zea mays]
Score 772
Evalue 2.84213e-80
Total Hit Count 378
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig670
TCCATTCATTCCGCTCAACATGGCTCCTCAGGTGTGGATGGTTGGGGAGGACGGCGAGGACCTCAAGAACCACGGGGAGCTCCTGCCTCTCTCCAAGCTC
CAAGAGATTGGTGTGTTATACTGGCATTTGGACCCAAAGAAGCCTGAAAGCGAAGAAGAGCTAGCGAAGATCCGCAAAGACAGAGGATACAACTACATGG
ACTATCTCGACATATGCCCTGGAAAGTTGGCAAACTTTGAGGAGAAGCTCAAGAACTTCTTCACAGAGCACATGCATGCCGACGAAGAGATCCGGTACTG
CTTGGAAGGCGGCGGGTACTTTGATGTGCGCGACAAGGATGACAAGTGGGTTCGGATCTGGATAAAAGAAGGGGGCATGATCGTGCTGCCGGCTGGAATT
TATCATCGGTTCACCCTCGACGCCGCCAACCATGTGAAGCTCATGAGGCTCTTCCTGGGAGAACCAGTGTGGACGGCGCACAACCGGCCTCAGGAGGACC
ATCCGGTGCGGCAAGAGTATGTCAAGAGGCTCACGGACGACAATGCTGGTCTTGCTCTGGCAGCACACTGAAGTTTGTTTGTGATTCCTCAGCTATGTTT
TATAAACACCCATGGACATATACATACACTTGGATGAAACCGTGTTGTAATCTTGAAACCAGATAGATATGCTACCTACGTACAGTACTTGTTAATATTC
ACTAGGTAATTGCATGTGCTATACTGCCATATCAAACTCTCAAGTGCTTAAACCCCAGTTTTGATTTTAATCCTT
page-top