Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig634
Contig Information
Length 584 bp
Tissue Shoot with ABA treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whva11c03    rwhva11c03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein TGME49_080650 [Toxoplasma gondii ME49]
Score 82
Evalue 1.55238
Total Hit Count 9
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig634
AGCCGTGACCTTGCTCATCTCCTTCCTCTCTCTACTCCTCCCTCCCCTACCCCCATGTTACAGAGGGCTATTGAGAGTGCCCGCGCGACACCCTTCAGAG
CTGCTGCAAAGGGGGAGTTGCGCTGCTAGCGTCACCATGGGTCACCCAGGTGAGCTCGTCGCCATGGTGCGCACGTCGTCGCCCTCGAATGCTGCGACAA
CACCTGCTGCTGTTGCCCTCTTTTTCTAGGTAGGGGACGGCGGGCGGGGGTGCTGCAAGCAGCAGAGCCCCCTGTTTTTGGGGAGGCGACGACGGGCTAC
AAGCGAGCGGCCACCGCCATGCACCGATGCGATTCGCCGGCGAAGATGCTGCTACACTAGCGTGGCGGAGCTGCAACCGTAGTTCGGTGCAGCTACAACT
GTAGGCCGGTGGAGTTGCAACCGGCAAAACTAATGCTGGAACCGGCGACAACCGTGTTGCGACGGCCACGGCGGCGATCCATCATTGCTGGAACCAACAA
TTTTTTTGCTGGAAGTCGGTGATTCTTTTTGTTATGTCCCCGCGGCGATGATTCATATTTTTTGCTGGAAGCATAAAAAAAAAA
page-top