Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig461
Contig Information
Length 970 bp
Tissue Shoot with ABA treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whva11d10    whva12j19   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit phenylalanine ammonia-lyase [Hordeum vulgare subsp. vulgare]
Score 1300
Evalue 4.44314e-143
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig461
CTTTTTTCAGGACAAAGATCAATCCAGATACACATACACCTGCCGACGTTTAGCTAGCGTACTTCCAGAATCCAGATACACATACACCTGCCGGTGTCCA
GCTAGCTCGCTTGCTTTAGTACTTCTCTGCATCTTCCGATGGAGTGCGAGAACGCACACGTTGCCGCCAACGGCGATGGCTTGTGCGTGGCGCAGCCGGC
GCGGGCCGACCCACTCAACTGGGGGAAGGCGGCGGAGGAGCTCTCGAGTAGCCATTTGGAGGCGGTGAAGCGGATGGTGGAGGAGTACCGCAAGCCGGTC
GTGACGATGGAGGGCGCCAGCCTGACCATCGCGATGGTCGCCGCGGTGGCTGCCGGCAGCGACACCAGGGTGGAGCTCGACGAGTCCGCCCGCGGCCGCG
TCAAGGAGAGCAGCGACTGGGTCATGAACAGCATGATGAACGGCACCGACAGCTACGGTGTCACCACCGGCTTCGGCGCCACCTCTCACCGGAGGACCAA
GGAGGGCGGCGCTCTCCAGAGAGAGCTCATCCGATTCCTTAACGCGGGAGCCTTCGGCACCGGCACCGACGGCCACGTCCTGCCTGCCGCGGCGACGAGG
GCGGCGATGCTCGTCCGAGTCAATACCTTACTCCAGGGATATTCTGGCATCCGCTTCGAGATCCTCGAGACGATCGCCACGCTCCTCAACGCCAACGTGA
CACCATGCCTACCGCTTAGGGGCACCATCACCGCGTCTGGTGACCTCGTCCCGCTTTCCTATATTGCGGGACTGGTAACCGGCCGCCCAAACTCCATGGC
CACGGCTCCGGATGGCACCAAGGTTAACGCGGCGGAGGCATTTAAGATTGCTGGCATCCAGCATGGCTTCTTCGAGCTGCAGCCCAAGGAAGGCCTTGCT
ATGGTGAACGGCACGGNCAGTGGGGCTCGGGGCTTGCATCCATGGTCCTTTTCNAGGCTAACATCCTTAG
page-top