Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig416
Contig Information
Length 548 bp
Tissue Shoot with ABA treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whva11c06    rwhva11c06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_06649 [Oryza sativa Indica Group] (no hit)
Score 784
Evalue 9.38502e-82
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig416
TGGGCTCTCTCCAGATCCCCTTTCCCTCCTCCTCCACGACGCGCTCGTCGCCGGCCACTTCGCCCCGCCGCGACCACCGCCGCCCCCGCACCTCGTCGAC
ACGTCTACGAGGTCCACCATCGCCCTCTCCATCGGTTGGTGCCGCGCGTTGGAGCTCCTCAGCTCTGCATCACGAGATCGCCGTCGTCTTCTTCCTCTTC
GGTCGCCGGCGTCGTCGTCGATTCCGACGAAGCCTGCAGCTCCTAAGCCTCCCAACAGCCTCCGTGTGCCTCTGTGATGTCGGAGCCCAGGAGCCAGATG
CCACCGTCGATGCCTACTACGTGGAGACCGCCGACGACCAGGAGTAGTTAGGAGGCTCCCGGGCAGGAGGCCTTGCCTTTTCGATCGTTGCTACTTTTGT
GCTAGCCTTCTTAAGGCAAACTTGTCTAACTTATGTCTGTACTCAGATATTGTTGCTTCCGCTGACTCTTGTGTATTCGAGCTTATGTATTCGAGCCCTC
GAGGCCCCTGGCTTGTAATATAAAGTTTGTATTATTTTAAAAAAAAAA
page-top