Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig368
Contig Information
Length 770 bp
Tissue Shoot with ABA treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whva11c12    whva11c23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Beta-amylase; AltName: Full=1,4-alpha-D-glucan maltohydrolase >gi|1771782|emb|CAA67128.1| beta-amylase [Triticum aestivum]
Score 1034
Evalue 3.00698e-120
Total Hit Count 317
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig368
CGGTGAGTGAGTGAGCACGCAAACCAGTGTTTGTAGCCAGCAGCCGCAATGGCTGGGAACATGCTAGCCAACTATGTCCAAGTCTACGTTATGCTGCCGC
TGGACGTCGTGAGCGTCGACAACAAGATTCGAGAAGGGCGATGAGACCAGGGCGCAGCTGAAGAAGCTGACGGAGGCCGGCGTGGACGGCGTCATGATAG
ACGTCTGGTGGGGGCTGGTGGAGGGCAAGGGCCCCAAGGCGTACGACTGGAGCGCCTACAAGCAGGTCTTCGACCTGGTGCACGAGGCCGGGCTCAAGCT
GCAGGCCATCATGTCGTTCCACCAGTGCGGTGGCAACGTCGGCGACATCGTCAACATCCCCATCCCACAGTGGGTGCGCGACGTCGGCGCCACCGACCCG
GACATTTTCTACACCAACCGCGGCGGGACGAGGAACATCGAGTACCTCACCCTTGGAGTGGATGACCAGCCTCTCTTCCATGGAAGAACAGCCGTCCAGA
TGTATGCTGATTACATGACGAGCTTCAGGGAAAACATGAAAAAGTTCTTGGATGCCGGTACCATCGTGGACATTGAAGTGGGACTTGGCCCGGCTGGAGA
GATGAGGTACCCATCCTATCCTCANAGCCAGGGATGGGTCTTCCCGGGCGTCGGANAATTCATCTGTTATGACAAGTACCTGGAAGCANACTTCAAAGCA
NCAGCGGCAAAGGCTGGCCATCCTGANTGGGAATTGCCANACNATGCTGGGANAGTACAACNACACTCCC
page-top