Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig349
Contig Information
Length 849 bp
Tissue Shoot with ABA treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
rwhva15c04    rwhva5n10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os02g0816600 [Oryza sativa (japonica cultivar-group)] >gi|113538045|dbj|BAF10428.1| Os02g0816600 [Oryza sativa (japonica cultivar-group)]
Score 992
Evalue 1.03264e-105
Total Hit Count 187
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig349
ATATACATCATGTTTCTGTACATCATTCTATCATCTTGTATGTGTGTGTTGTTTGCATGAAAGGAAAAGGAGAAATAACTCTTTAATTTCCTGTCAAAAG
AAGAAGAAAACAAAAACTAAAAGCGCTTCACAAAAATGATTCCCGGATCACCCGTGCGAATACACGTGATGACAACCGGCTCAAGACATCTGGTAGGATC
TTCGACGTGATGCTCGGCAACACGGGTAGAAGCTCTTGCACCAGAGACACGACATTTACGTCCCCGTTGACTGTTGGATTTGCCGTCCCAGCCGATAGAA
ACTTGACGACCTTCTCGACATTGTTCAAGATGATCCTGTCTTCCTCTGTGATTGTAGGAAGCAATGCTCCGGACCTCACAGGAACCATGCCGAAAACCGG
GACGGGATTTCTGACCCCGAAAGATGAAGCAATTTGTAGCAACTGCTCCCTTGAAACCGCGTCGATGGCTTTCACAATCTCGTCAAGAATGAACTCCCGG
AAGAAGTCACCCCTGTCAGAGAGTAGAAAAGAGAGAGCCGCCCGAGCTTTGATTGGGTTCTCCGGTTGGGAGATGGCCATTGGGAATGCAGGAACTAAAC
TGGTGCTAGGTTGGAATCCTATAGCACCCAGCTCAGCCATGTTACCCTTCATGTCCTCCCCACCACCGCTCTTTGCTGCACTAATGAAATTCTCGAAAGC
TTGCATCACGTCAATGAACCTCTCTGCGTCAAAGACACCTGTTTTGCCGTATATTGTGTAACGCAAGGCACTCCTTAGTCGAGGTGATTCATCCGTTAGC
AGCCTCTGTGCAATATATGGATATGCTTCATCCACAATGGGCAAATTCA
page-top