Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig248
Contig Information
Length 548 bp
Tissue Shoot with ABA treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whva11e13    rwhva11e13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unnamed protein product [Oryza sativa Japonica Group]
Score 320
Evalue 3.35709e-28
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig248
GGGAATGAAGACCATGTAGCACGGGGCTCTTCCTCAGCACGCTCTCGCTCGGCTTCTTCGTCAGCTCGGCGCTCGTCACCGTTCGTGCACAAGATCACCG
GTGACCGCCGGCCCTGGATCGCCGACGACCTCAACAAGGGCGAGCTCTACAAGTTCTACTGGCTCCTCGCGGGGGTTTGCCTCGCCAACCTCGTCGTGTA
CCTCTTCGCCGGCAGGTGGTACAAGTACAAGGCCGGAAGGCCCGGCGCCGACGGCAGCGTCAACGGCGTCGAGATGGCCGACGCCGAGCCGTGCCTCCAC
TGACTGACCTCGCGACGCGCCTGTTCGTCCGTCGTTCGTGTTTCTCAATCGGACGGCCTTGATTTCTTCGCGCATGTTTGTACGATATACATACTAGTAT
TGGATGGATCGTCGCGCGGTCGTCCACGTGTGCCTACGTGTAGTATAATGGGATTAATAACTTCTTAGAGGTGGGCAATGGAAAAGCCGGGCGGGGAAGG
GTGTCGGTGACTGAATGTCGCTGCATTTTGTGAAAATTCCCGCCCAGA
page-top