Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig247
Contig Information
Length 501 bp
Tissue Shoot with ABA treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whva11e24    rwhva11e24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0200000 [Oryza sativa (japonica cultivar-group)] >gi|20804509|dbj|BAB92203.1| putative autophagocytosis protein [Oryza sativa Japonica Group] >gi|113531844|dbj|BAF04227.1| Os01g0200000 [Oryza sativa (japonica cultivar-group)] (no hit)
Score 1399
Evalue 1.35381e-152
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig247
CACCCCCCCTCTTCCTACATTGGTTTGTTTGTTGCGTTCTTTCTCAGGAGATATGCTGCAGCATTAATAACATCTACAGTGATACACATGTTACACTGAT
GAGATGATTGTCATCGGCTGGCTGCATCTTTCGATCCTGGTTGGCATAAGCTGAAGCTAGCATGTCAACATGGAGGACAGTTTTTGCCAAATCTTCAAAC
TAAACGAGAGATGGCCTGAAGCTACTTGCAGAAGTGTCTTTATCTATCTATCCGGGCTTGACCTACTTGCTGCACGGTATTGGTAGGGCGCCCTGTATTA
AAGCGACTTGTCTTCACTATAGTTTGCCTAGTTGTTGGTCCGGAAAAGCAGATGGGATACGGTACCGCATACCCACCCGGTTTGGATGTGGTTTAATTAG
GACTTGTTGCTGTCTTTGGACAAGACTTTTTACCTACTGTTTATTAATGGGTGTGACCTGCACCACCGCCACCGGGCAATTTGCATCGAATAAAAAAAAA
A
page-top