Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig245
Contig Information
Length 612 bp
Tissue Shoot with ABA treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whva11f07    rwhva11f07   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_37978 [Oryza sativa Indica Group]
Score 328
Evalue 5.23808e-29
Total Hit Count 170
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig245
TGCAAGTATCACCATCCAAGGTCACTTGTGCCTCCACCAACAGCCGGAGCTCTTAGTCCTCTTGGCTTGCCACTCAGATCTGATCAGCCCGTGTGCACAT
ACTATGAACGTTATGGAGTCTGCAAGTTTGGACCAGCTTGCATGTACAATCACCCTTTTAATTTTGGTCATCCTGTATCCGCAGCAGGGCCACCTCTCTC
TGCTCAATACCTCACTTCAGGAAACTACACGGTCTAGCAAGCAGGGCCGATTTTTCTCTGTGGTCGCCATGATGCTTGGAATAACACTTCCACTTGTAAA
ATAGCGCAGCTGAAAGTTGCAGGGTTTTCATGTTGACGATAGAGATCTGGTTTGCAAGTCAGCAACGAAGTTGCATGAAGTTGGGTGCATAGCCGCTGGG
ATTCGTAGAAACTAAACACGTTTCGATACATGACACTGCTGCCCCTTTATATTGTAGAGCACTTGACGGTTCGTACACAATTGTTGCGTCAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAANAAAAAAAAAA
NCAAAAAAAAAA
page-top