Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig243
Contig Information
Length 997 bp
Tissue Shoot with ABA treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whva11f14    whva4c09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_10095 [Oryza sativa Indica Group]
Score 608
Evalue 6.61818e-90
Total Hit Count 160
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig243
GTTTGCTGCACAACATTACCAGTATCCAGCTTATTATCAGCCTCCTACCCCGATTTCTTCTACAACTCAAGGTGACCAGCAGCATTCAGCCAATGCTGAT
AATAAGCCAGCAGCTAAGGCAGATGCTGCCAAAACAACCACAAATGTTGTTCCTAATGGTACTGCTCAGAGTAACAGCGGAACTGCTCCCCTTGGGTCAA
GCTACCAGAATTCATCACTGACCCCTGATGGAACCTATAGGGCACCCTTGATAGGTGGAGTCCCTTCTACTGGTTACGTGGACTCAACCTATGGGTATGA
CACCACAGGGGCACACTATGCTTGGTATGATGGTTCTGCCTATACCAATGCACAGCAAAGACCAACTACAGCTAATTACACGCCGTCTTCAGCGTATAAT
AGCAATGGCTCTTCTGCAAGGTATCAGACCAAGAGCCCCACACCGCAGCAGACGGGCAACAGGAGACCAACGACTACAACAGGGTCAGCTACTCCTACAT
ACCCAAACAGGATGTACTCGAGCACCCAGTCTTACAACCAGTACGGAAATTCGGTCAAAACTGGTCTTATGTATGGAAACACTGGCTACGGAAGCACTGG
CTACGGAAGCACTGGCTATGGAAGCAGCGGCTATGGCGGCAGTGGCTACGGAAGCAATGGCTATGATTCCAGGTTATATGGTCGGTGGGGTGTTTCTATG
GATAGCAGATACAACAGGCCCAGAGGCCGTGGCAACGGATATTATGGTTTTGGCAATGAGAGTCAGGATGGAACAATTGAGCTCAACAGAGGTCCTAGGT
CTGGGTCGTTTCAAGAACCAGAAAGCATTTGGCCATACTGTTACTATCGCTGTGAAAGGGCAGACCCTCCCTTCAAGTGAAAACAAGAATGCTAGTGACG
TACCTGATAAGGCACAGTTCAACCTANAGGATTTCCCTGTCCAGTATGATGATGCAAAGTTTTTTGTCATCAAATCATACAGCGAGGATGATATCCA
page-top