Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig242
Contig Information
Length 753 bp
Tissue Shoot with ABA treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whva11g21    rwhva11g21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_10012 [Oryza sativa Indica Group]
Score 906
Evalue 7.77378e-96
Total Hit Count 126
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig242
GCCGGGGAAACTCGTTCTATTGTCTGTAGTGCTCGAAACTTTTTCCAGTTTACAATGCCAGGAAAGGCATGGTGGCAGTTTGTCCCTCGATGGTACGAAC
ATTGGACCTCAAATTTGGTCTACGACGGCGATATGATCGTGCTTCAAGGCCAAGAGAAGGTTTTCCTGTCTGCATCCAAGGAGTCGTCTGCAGATGTTAA
TCAGCAGTACACAAAGCTCACATTCACACCCACACAGGCCGACCGATTTGTTTTAGCATTCCGGGCATGGCTACGGAAATTCGGAAATAGCCAGCCTGAC
TGGTATGGAAGTCCTAGCCAAGATGCATTGCCTTCTACGGTCCTTTCAAAGCGAGAGATGCTAGACAGATACGAGCAGCACACGCTGAAATGCTCCTCCT
GCAGAGGAGCGCACAAGGCCTTTCAGACTTTGCAGAAGGTGTTCATGGGGGCGACGGTGGTGTTTGGCGCGACATCCGGGATCCCTGCGGATGTTCAGCT
CAGAATATTGCTCGGTGCCGGTGCTCTGGTCAGCGCCGCTCTGGCCTATGTCTTCTACGACCGCCAGAAGCATTTCGTGTTTGTGGACTACGTGCACGCT
GACATTGATTGATTAGGGAGATAAACATTAGTTATTTTTGTGAGGATCTGGTGTGGTGTGGTGTGGAGACATCCCACGATCAATCATGTGCATAACCTAG
CCAAGGAGTACATATAGCTTTCAGTGGGTACATGAGATGGCCCAGTATGTGTT
page-top