Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig100
Contig Information
Length 680 bp
Tissue Shoot with ABA treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whva4m19    rwhva4m19   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit NAC domain-containing protein 68 [Zea mays]
Score 86
Evalue 0.768889
Total Hit Count 6
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig100
GAGGCATCCTCGACACCAAAGCTCATCTTCTTCTCCTTGAAATCTTTTTGGGTTCATCAGATTTGGAGGATGTCTTGCAACTGTGGATCCGGTTGCAGCT
GCGGCTCAGACTGCAAGTGCGGGAAGATGTACCCTGCTCCCTTTACCACTACCGTGCAAGGACGTCCCTGTGAACTACAAGCTACACCTAGCTAGTGCGG
CTATTAGTTCGTACATACGTGCTCGAGCCACTGAGCTGAGCTAGTTTGTGCGTGCTATTACAAGCTGTTGCCAGGTGGTCAGCGGCAGCCATGGAGAGGA
CGCCGGTGATGGTGAGGCAGGGCGGCCAGGAGGTGCTGAGGCAGCTGCCGCCCGGGCACCGACGCGCACCGCACGATGCCACCGATGCCACCATCGCCAT
CGTCGTCGTCTTCCAGCTGCGTCACAAGCGGCGGCAGCTCCTCAGACCTGCAGGAAGAGGTCAGCAGCTGAGAAGCCAAGCAAAGCTGCTGCCTACTGCC
TCTCCAAGAGACACTGACTAGCTAGCTTAGCTAGGCAGATTACGAACCAGGGGAAAGAAATGATGTGTCCTTTTCTTGCTCCAACATTTGTTTTTCTCTC
CATCTCTTTGCTCTCTTTCTCCGTGTAATATGTAATGCAGTGTGATGATGTAGCGAGAAGCAAGTCAGCAACCAGGCATT
page-top