Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig97
Contig Information
Length 310 bp
Tissue Shoot with ABA treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whva4f17    rwhva4f17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays]
Score 162
Evalue 4.87408e-10
Total Hit Count 35
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig97
CGAGGGTTGCTTCTAGCTGGTCTCGGGAAGAGAAGGACCACTGCCTGGAGGAGACCGAGAAGTCGTTCGCCTACTCAGGAGATCTCCTACGCCAGATATT
CACCTAAGCCAAGAACGATCACCATTATGTTTCACGATAAACATTGTAAATACTAAGCCATGTCTGTGCACCGGGGAGGAACATGCTCTGTCGGATCTGA
ACTGCCTTGCAATCAAATTGTCATATACTAATAATCCTTCCCTTGCATTTGCCTACTCTTTGCCTTTTGCTGATACACACTTTGGCCCCCCTTTTGCTGC
AAAAAAAAAA
page-top