Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig96
Contig Information
Length 948 bp
Tissue Shoot with ABA treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whva4f22    rwhva4f22   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_05322 [Oryza sativa Indica Group]
Score 245
Evalue 5.14642e-19
Total Hit Count 128
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig96
ATTCGGCACGAGGCAAGAAGCCACACGTACTCGCATCCATCACACTAGCTTGCTTAGCATCGCCACCTGCTCTTAGAATGGCGGGCTACTACAACGGCGG
CGGCAGGACCATGTCCTACTCCAACAACGATGAGTGCTTCGATGGCGGCAGGACGATGTACTCCAACACCACCGACGACTGCTACGACGCCGGCAAGCAC
GGGCACGGGCACGGGCATGGCCATGGCCATGGCGGGGCAAACATGTACGCTAACACCACTGACGTGGAGTGCTTCGAGGACTCCGGCAGGCACGGCTACG
GTGGTGGCGGCAGGACCATGTACTCCAACACCGTCGACGAGGAGTGCTTCGACTCCGGCAGGCACGGGCATGGGCACGGCCACGGCTACGGGCACAACGA
CGGTAGGGCCATGTCCTACTCCACCACCACCGAGGAGTGCTTCGGCGGAGGCGAGCAGGGCCAGGGGTACTATAAGAAGGAGGTGAAGCAGCACAAGAAC
AGGGAGCGCGTCGGCGAGGTCGGCGCACTCGCCGCCGGTGCCTTCGCCCTGTATGAGGGGTACGAGGTGAAGAAGGACCCGGCACACGCGAGGAAGCACC
AGATCGAGGCCGGTGTGGCGGGGGCGGCAGCGCTCGGCGCCGGCGGCTACGCGTACCACGAGCACCGCGAGCAGAAGCAGGCCGCCTACGGCGGGCAGCA
GGAGTACAGGATGCCCGTCCACAACGGCTACTGCAACTAAGTGCACGCTACCAACGTCGATCGATCGTCGTATAGACTCCAATAATAAAATCGACAGAGC
ATCATGCAGGCAGGCATGCTGCATGCATGTGTTGCTTAAGTATTGTTAATTTCGGCTTATCTACAATAAGCTAGCTGCATGCGTACGTTCATGCTACCAG
TCGCGTGCTCTGTGGTGTAACTTGCATATGGTACAATACGGTCGACAG
page-top