Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig95
Contig Information
Length 1133 bp
Tissue Shoot with ABA treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whva4g13    rwhva4g13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit basic helix-loop-helix protein [Hordeum vulgare subsp. vulgare]
Score 830
Evalue 9.94596e-87
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig95
GAGGTACTACCACACTAGGTCCCCTCTCATCTCCACCATCATCTCTAACCTCTCAGAGATCAAGCAGAAGCCAGCTGCGACCTGCGAGCAATGGGGCACC
AGCACCAGATGTTCAACGACCCCTTCGCGAGCAGCATGTCGTCACTGGAGGAAGACATGTTCTCCGGTGCCGGAGGCTACCACCACCTCACGCCGTCCAT
GCAGTGGCCGGGCTTGGATAACGACATACCGTCGGCGCCGGCTGCCAACAACGCCACCTCCTCCGGTGGCTCTGGATCACACCGCAAGATGAGTCACAAC
GCGTACGAACGTGACCGCCGCAAGCAGCTCAACGAGCAATATTCCTCCCTCCGCTCCCTCCTCCCCGACGATGATCACACCAAGAAGATGAGCATTCCGA
CCACGGTGTCGCGGGTGATCAACTACATCCCGGAGCTGCAGAAGGAGGTAGACCGCCTGGAGAAGAAGAAGGAGGAGCTGAGGCGGGGCAGCTGCGAGCA
AGGCGCCATGAGGCAGAACACGGCCCCGATCGTGTCCGCCACCTGCCTCGACGACAGGGAGATCATGGTCCAGGTCAGCCTGGTGAGCACCATGGCGGGA
GCTCTGCCCATGTCCAAGTGCATCAAGGTGCTGGAGAACCAAGGCCTTCGCCTCATAAATTCCTCGACTTCCGCGTTTCAGAACAGGACGTTCTACAGCC
TCCATCTTCAGAGAACCCAACGGACAATGAGCAAGGAGGGCCAAACATTTTGTAACGAATTGGAGAACGCTGTGAAGCAAAAGGCGGGACTACATCTACA
TCATTAGTAGATTATAACATAATAATGGTGCATGTCATCATACATAACGACCATGAATCAAAATGCATGCCATAGATATAGGACAAATAATCTAAGATAA
ATAGTACTGATGCATGCATGACAATATAATACAGTGTGTTCCATATAGCTAATATAGTGTATACATTTCTTGTCCTATATTTTCCTCTTCATCATGTACT
CTGGCATGTGCACAACTTCGGGGTGAGTATAATTAGTACCCATGAAACAATGGAGAAAATAAATATAGAGATGGCCGCGAAGCAGTGGCATGCATAAAAG
ACAGGCCATTGTCGATGTAATTCTTCGTATAAA
page-top