Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig94
Contig Information
Length 423 bp
Tissue Shoot with ABA treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whva6l16    rwhva6l16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_11300 [Oryza sativa Indica Group]
Score 327
Evalue 3.64989e-29
Total Hit Count 8
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig94
ACGAGGTTTGCCCGAGTCACACATAGCAGGTACGAGAACGCCACTCCTGACTGGACCGTGTTCTCGACTCACGATCCGCATGCGCAGTGGAACCTCCTGG
TCATGGAGGACAACTACACCCCGGCGTGCCCGTATGCGCATCATGATGGGGGTGAAAGCTGGCACATGACAGGCCAGATGTGCATCCCAAAAAGGGTCTG
TTGATCTTACGCCGCTATGTCGGAATGGCCCAGATAACTGTGCCTTTTGCCCGCTTGGGCTCATACTGTTGCCTGGATTTATTGCTTGAGATGTATTTGT
AATTTCTGTTTGGATTGCTGTCTATTTGGGTTGGTGTTGAGGTGATTTGCCCGGACCATTTGCATTATATACATTTCATCTTGCTGTAATATAAGACTTC
AGAGTTTTACACGAAAAAAAAAA
page-top