Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig93
Contig Information
Length 651 bp
Tissue Shoot with ABA treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whva4g18    whva4h05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_00561 [Oryza sativa Indica Group]
Score 1018
Evalue 5.90929e-109
Total Hit Count 299
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig93
GGCACGAGGCCTCGTGCCGCAAGGAAGCACAAGGTGATCCATTTCAATAAAACGGATGCCCGGCTAGCAAACAATGGCATTCCTATCCATCTCCAAATGC
TGCGCTGCCGTGTCAACTTTGAGGCTTTGAGATTCACTCCACAGATTGAGGCCCTTGGCAGAAAACTTATCTCCACCCTTCAACGAAGTGGGGAATTTGT
TGTGCTTCACTTGCGTTATGAAATGGACATGCTCTCCTTTTCAGGCTGCACACATGGCTGTTCCGATAAAGAAACTGAGGAGCTCACCAGAATGAGATAT
GCATATCCATGGTGGAAAGAAAAGGAAATCGATTCTGAAACCAAGAGGCTTCAGGGACTTTGTCCCCTCACACCTGAGGAAATTGCTCTAGTGCTTAAAG
CTCTAGGGTTTTCAAAGGATACGTTGATATATATTGCCTCTGGTGAAATCTATGGAGGTGAAAGACGGTTGGCTGCTCTTAAGGCTGCCTATCCGAATTT
GGTTAGAAAGGAAAAACTGTTATCTTCCAATGAATTGTGGCCATTCCAGAACCATTCGACCCAGATGGCAGCACTGGACTACATGGTTTCGATAGCAAGC
AATGTTTTCATCCCCAGTTATGATGGAAATATGGCAAGACTTGTCGAAGGT
page-top