Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig92
Contig Information
Length 1282 bp
Tissue Shoot with ABA treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whva6l01    rwhva6l01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative late embryonic abundant protein EMB8 [Oryza sativa Japonica Group]
Score 981
Evalue 5.00439e-149
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig92
CGGCACGAGGCTACGCACCCCTGACGACGGAGCCGTCGCCCTCGACTGGGTCTCCGGCGACGACCGGGCGTTGCCGGGAGACGCGCCTGTGCTAATCCTT
CTGCCTGGTCTGACAGGTGGGAGTCAGGATACATATGTACGACATATGCTTTTGAGAGCTAGAAGCAAAGGATGGCGTGTTGTGGTATTCAATAGCCGTG
GATGTGCAAATAGTCCTGTGACCACAGCGAAGTTCTATTCTGCTTCATTTACTGGAGATCTCCGTCAAGTAGTCGATCATGTTTTAACCCGTTATCCTCA
ATCTAATATCTATGCTGCTGGCTGGTCTCTTGGAGCAAATATTCTTGTGCGCTACCTTGGCGAGGAGACTGATAAATGCTCCCTTTCTGGAGCAGTGTCC
ATGTGCAATCCGTTTAATTTGGTCATAGCAGATGAAGATTTCCACAAAGGGTTCAACAACATCTATGATAGAGCACTTGCTAACTCTCTGAGGGCTATAT
TTAAGAAGCATGCACTTCTTTTTGAAGGATTGGATGGTGAATATGACATACCAAAGGCAGCCAATGCAAAAACTGTTAGAGATTTTGATGAAGGCCTAAC
CCGAGTTTCATTTGGGTTTCAGGTCAGTAGATGATTACTACAGCAACTCAAGCAGCTCAGATTCTATCAAGAATGTTTCCATACCCTTATTGTGCATACA
GGCGGATAATGATCCAATTGCACCATCCAGGGGAATTCCCAGAGAAGATATCAAGGCAAATCCGAACTGCCTACTGATAGTAACACCAGAGGGTGGTCAT
CTTGGATGGGTAGCAGGCGATGAAGCTCCATTTGGATGTCCTTGGACTGACCCTATTGTTATGGAGTTTCTAGAACATGTTCACAATGAAACGGGCTCAA
CCAGCAAGAATAGCGTGGCCAATGAGCCGCAGGGTGTTCCAAAGACATCAGTACCACACTTGTCCGAACATGTGTAGAGATAGTAACATTGCGTTTCCAC
TCGATGCGCACGTTTTATACGCATAGTTAGGCTTCACTTGCTGTTCTGCAGCTGAAATGTGCTACACTTGCTCCACCAACACGAAGGTTCTGAACATCTT
AAAAATATATTGGGGTCGGTAATCCATCGCTGGCTCCCCATTTTACTGACATTTCGACATGAAGTATTTATTTGCCATTTGGAAGGCTTGCTGTATCAAA
CTGCACCATGTTGTATAGAGTATTTCAACCGCATTCATCCATGCATGTACCCATCACACCCTCTTGTATGTGTTCTCACACT
page-top