Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig91
Contig Information
Length 1073 bp
Tissue Shoot with ABA treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whva5k04    rwhva5k04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os05g0449500 [Oryza sativa (japonica cultivar-group)] >gi|53749250|gb|AAU90110.1| putative LRR-containing F-box protein [Oryza sativa (japonica cultivar-group)] >gi|113579251|dbj|BAF17614.1| Os05g0449500 [Oryza sativa (japonica cultivar-group)]
Score 1075
Evalue 2.7363e-147
Total Hit Count 439
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig91
ATCTTTCCTTTTTCTGCTGTACTCAAGAAGCTGGATTTGCTGTACAGTTTCCTCACCACTGAAGATCATTGCCAGCTCATTGCAAAATGTCCAAACCTAC
TCGTTCTTGCGGTGAGGAATGTGATTGGAGATAGAGGATTGGGGGTTGTCGGAGACACATGCAAGAAGCTACAAAGGCTCAGAGTTGAGCGAGGGGAAGA
TGATCCTGGCATGCAAGAAGAGGAAGGCGGAGTTTCCCAAGTAGGACTAACAGCGATAGCCGTAGGCTGCCGTGAACTGGAAAACATAGCTGCCTATGTG
TCTGATATCACAAATGGAGCCCTGGAGTCCATCGGAACGTTCTGCAAAAACCTCCATGACTTTCGCCTTGTCCTGCTTGACAGACAAGAGACGATAACAG
AATTGCCGCTGGACAGCGGTGCACGCGCGCTGCTGAGGGGCTGCACCAAGCTTCGGAGGTTCGCTCTGTACCTGAGACCAGGGGGGCTTTCAGATGTAGG
CCTCGGCTACATCGGGCAGCACAGCGGCACCATCCAGTACATGCTTCTGGGTAACGTCGGGCAGACGGATGGTGGACTGATCAGTTTCGCAGCCGGGTGC
TGGAACCTGCGGAAGCTTGAACTGAGGAGCTGCTGCTTCAGCGAGCGGGCTCTGGCCCTCGCCATACGGCAAATGCCTTCCCTGAGGTACGTGTGGGTTG
CAGGGCTACAGGGCCTCTCAGACCGGCCGCGACCTCATGCTCATGGCGCGGCCCTTCTGGAACATCGAGTTCACGCCTCCCAGCACGGAGACCGCGGGCC
GGGTGATGGAAGACGGGGAGCCCTGCGTTGACAGGCAAGCTCAGGTGCTGGCGTACTACTCCCTCTCTGGGAAGAGGTCCGACTACCCGCAGTCTGTTGT
GCCTCTGTATCCTGCGTGAGTGTAAATACATTAAGCCGGTATGGTGTCTCTGGGACGGCCCCTGGCTGGCTGGCCCTCTGCGCTTCTCGGGCAATAAGGA
TGTTTGTATGTGGGTATTGTATGGGTCTGGATCTGGTAGATTTTCTAGCTGCTGTGTACTGGAATAAGCGCAT
page-top