Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig90
Contig Information
Length 919 bp
Tissue Shoot with ABA treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whva6k12    rwhva6k12   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit threonine synthase [Zea mays]
Score 802
Evalue 1.26899e-83
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig90
GGCCTCGTGCCGCTGAGCTGCCCATATACCTCGCAAACTCACTCAACTCGCTTCGGCTGGAGGGGCAGAAGACTGCAGCCATAGAGATATTGCAACAGTT
CAATTGGCAGGTGCCGGACTGGGTCATTATCCCCAGGAGGCAATCTGGGCAACCATTTATGCTTTCTACAAGGGGTTTGAGATGTGCCGTGCTCTTGGGC
TAGTTGATCGTGTTCCACGGCTTGTATGTGCACAGGCTGCCAATGCAAATCCACTGTACCGGTATTACAAGTCTGGGTGGACTGACTTCCAATCACCTTG
TTGCTGGAACTACATTTGCATCTGCCATACAGATTGGTGATCCAGTATCTATTGACCGTGCGGTTGTTGCGCTGAAGGCAACCGATGGCATTGTTGAGGA
AGCTACAGAGGAGGAGCTTATGGATGCGACGGCTCTTGCTGACCTCACTGGGATGTTTGCTTGCCCACATACTGGGGTTGCACTTGCTGCCCTGTTCAAG
CTCCGTGACCAGGGTATAATTGGCACTAATGACCGCACGGTGGTTGTTAGTACAGCACACGGGCTAAAGTTCACACAATCAAAGATCGACTACCATGATA
AGAACATCAAGGACATGTTGTGCCAGTATGCCAATCCACCGATCAGTGTGAAGCCTGACTTTGGGTCTGTCATGGATGTTCTCCAGAAGAAGCTCAATGG
TAAGATCTGAGCTTACCTTTAATTAACCTCAAGAGTTCTATCTTGTTTATCGTCACAACGGCTGTACTTTGGCATCTTAATCAACTGCACTTGGTGACCA
TGGTATGGCGATATCATCTTTATTTTCCAGTACTAGGTTCTTGAGGCTCTTCTAACTATAGGCAAAAGTGGATAGAGCTTTCCTTGTACTTTATCTGTAT
CATGTAATAGCAATAATAA
page-top