Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig89
Contig Information
Length 628 bp
Tissue Shoot with ABA treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whva4h14    rwhva4h14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hCG2045694 [Homo sapiens]
Score 89
Evalue 0.285346
Total Hit Count 15
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig89
GCAGTGCAGATCCACCATCCGGCCGGAGCTCCTTTCCATCTCCCCTCCCCACAGCCCCACCTCCTCCTCCCGGACACCCGATTCTCCTATGAACACCATC
TCGCCCTCCTGCTCCTCCATACACCACATTCCTCGCCTACAATCGATTCGAGGGAGGCCCGAGGAGTGTCAAGGCCTCATTTTTCCTCTTTAGCTCAGCC
ACCAACGAGCTACTCCTCCCCCACGCCATGCTTGAGTGTAGTTCGCCACGGGCACGCCCATACAAGGCATGTGGCGTCGCAGTGACGAGCGAGTGTGGAT
GTACATCAGTACATTACTATGCAGTCTACTGCAAACCGGCTGGATTTTTGTTGAGTTCTTTCTGCTATGTTGATGAATCCTTTTATGTGATGAATACTTG
GACAGGTTGCTGCAGCTCAGTTCTTCTTTGCATTTTTCAGATTTTGGATGTGTGTGGTATCACTGCAGTACACTTCTAGCGCTGCAGCAAAACAGTAGCG
GGCATGGAAGTTGGTGGCAGCATACAGTTTGGCTGGGCATGGCCGCATGGGTTGCAGTTCCCTGTGACGACAAGGAGGGTCACCTCTCGCTATAATGCAG
TTTGTTTATTTATGTGTGACTAAATTCT
page-top