Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig87
Contig Information
Length 746 bp
Tissue Shoot with ABA treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whva6k04    rwhva6k04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Two pore calcium channel protein 1; AltName: Full=Voltage-dependent calcium channel protein TPC1; Short=TaTPC1 >gi|34391395|gb|AAM47032.1| putative calcium channel [Triticum aestivum]
Score 292
Evalue 1.19375e-24
Total Hit Count 14
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig87
ATTTTGTCAGCTTTTACCTTATTTCAATATTACTACTGCTTAATCTGATTGTAGCATTTGTGTTGGAGGCATTTTTTGCTGAGATGGAACTGGAGAAAGG
TGAAGAGGTTGATATCCAGAATCCTACGTCTGGAGGAATAAAGAAACGCCGGTCTATGCGTGTGAGGTCAAAGGGTACGATGGTTGATATTCTTCTGCAC
CATATGCTGAGCAATGAACTTGATGGATCTCAAAACTCTTGAACAATGACTGGATGGAAGCAAGAAAATACACGGACGCTTCCTGGTGAAAGTACATGAA
TGATTACAGCCAGTATATTCCCAAGCATGGAGTATGTTGCAGCCGCGATAAATTTCTGAGTAGTGCTGTAACGGACTCGATTTACTTCCTCTTTCAGTAT
CAAGAAATACATCGAATATGCGTATTTGTATCCGGTCGATTTGATACTGCTCTCTGTCAGGCTGATAAGAGTTTGGTAGAGTTTTATATACACTCCGTCT
CAGTCAACATACCAACAAGCAACTAAAGAAGAGTTCAAGTCACCACTTCAAAGTGTAGTCAGCAACTTGTATAAAGCAAAAGGAACTGTACTGGAAATCA
ATATGATACTACAGGCTCTGGTGCTTTTTTCTGTAACTAATCTTATATCAGTTGAAATACTATCAATATATGACACTACAGGCTCTGGTACATTTTTCTG
TAACTGGTCTTATATCAGTTGAAATACTGGGCATTTAAAAAAAAAA
page-top