Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig86
Contig Information
Length 509 bp
Tissue Shoot with ABA treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whva6k01    rwhva6k01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os04g0530200 [Oryza sativa (japonica cultivar-group)] >gi|113564958|dbj|BAF15301.1| Os04g0530200 [Oryza sativa (japonica cultivar-group)]
Score 81
Evalue 1.3704
Total Hit Count 6
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig86
CGAGGCCTCGTGCCGATTTTCGCCACCCAACCCGGCAAATCGCCAATCGCCATCGTCTTCTTTGTCTCCTCCAGCGAGCCACAGGAATCCTCTCCGACCA
AGAAGAGAAGAGAGAAGAGATGGGAGGGTTCCAGCGGCAGGTGAAGGAGCGGACCATGGAGGTGAAGGTGGCGGTGCTCAAGGGCGTCAGGGTCGTCGGC
GACTTCGGCAAGAAGACGTGGAACAAGGTCAAGGCCATCAAGCGCTGATCGATCCATCCATCGCATCACCCCGGCCGTCTGCTTCCCTTCGCTCCAGTCC
ACTAGTTGCTTCATGTAGTACTGCCTGATAGGATAGCCGTCTGGCCTTGTGCTCTCTTTTTTTTCTCTGGTTGTGGTTGTGATTTGGTTTGTTGGATCTG
TTTTTGAGTCAACTTTTGATGTGAAGAATCGCCTGTCAGTATAGGCTTATATTTAGCCTTCTTATATTCCCTTGTTTAATATTATTATTATTCCTTCTCA
AAAAAAAAA
page-top