Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig84
Contig Information
Length 444 bp
Tissue Shoot with ABA treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whva6j16    rwhva6j16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Photosystem I reaction center subunit III, chloroplastic; AltName: Full=Light-harvesting complex I 17 kDa protein; AltName: Full=PSI-F; Flags: Precursor >gi|469560|gb|AAA68147.1| photosystem-I PSI-F subunit precursor
Score 287
Evalue 1.54709e-24
Total Hit Count 96
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig84
CGAGGCGCAGCTACCTCATCGCCGTCAGCGGCGAGAAGAAGCCCGCCATGAGGGAGATCATCATCGACGTCGAGCTCGCCGCCAGGATCATCCCCAGGGG
CTTCATCTGGCCCGTCGCCGCCTACCGCGAGCTCATCAACGGCGACCTCGTCGTCGACGACGCCGACATCGGCTACTAATCAGCGGCCATGCGTGCGTGG
TTGGCTAGTCGGTCCCAACTCAGATGGACAGCGGAGGATGGATGAGGGCTTGTGGTGTCGATCTGTGTGGGCTTGGTGTAGGAGCTGATAGGATCCTGGA
GAAATGGAAGCTCTCTTGTATTTAAGAAACTGAACCCAATCTTGTATAACTATTGTGTTCTCTCTTCACATTTGTGTATTTTACCATTGTTCAAATTGTT
GAGAACAAAAAAAAAAAAAAAAAAAAAAAAACCCNAAAAAAAAA
page-top