Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig83
Contig Information
Length 1350 bp
Tissue Shoot with ABA treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whva6j11    rwhva6j11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os12g0604800 [Oryza sativa (japonica cultivar-group)] >gi|108862932|gb|ABA99824.2| tetratricopeptide repeat protein, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|113649727|dbj|BAF30239.1| Os12g0604800 [Oryza sativa (japonica cultivar-group)] >gi|215706934|dbj|BAG93394.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218187204|gb|EEC69631.1| hypothetical protein OsI_39024 [Oryza sativa Indica Group]
Score 748
Evalue 3.17627e-149
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig83
AAAAACTGAAAGAAGACGAGGAGCTCGCGACCCCAAAACCCTAACCCCTGTAACCCTCGGCGGCGGCGGCGGTGGCGATGGCGGACGGAGGCGGTGGACG
GGCGGCGGAGCTGAAGGACCAGGGGAACGAGCACTTCAAGTCCGGGAACTACCTCAAGGCCGCCGCGCTCTACACGCAGGCCATCAAGCTCGACTCCGAC
AATCCCACCCTCTACAGCAACCGAGCTGCTGCATTTCTGCAGCTGGTTAAGCTTAATAAGGCACTTGCTGATGCTGAGACGACAATAAAACTGAAACCAG
AGTGGGAGAAGGGTTATTTCAGGAAAGGATGTGTTTTGGAGGCCATGGAGCAGTATGAGGAGGCAATATCTGCTTTTCAAATAGCTTTGCAGCACAATCC
ACAAAATACAGAAGTCGCGAGAAAGATCAAGAGGCTTACTCAGTTAGCAAGGGAACAGAAGCGAGCTGTTGATGTGGAGAACCTGCGTTCCAATATTGAC
ATTGGGAAGAACTTGCAGTCATTGAAAAAGGAGCTGGTTACAAAGTATGGAGATGCAAAAAATGGGACAAAATATATTCTCATTTGTTATCAGTGTGATT
GAATCAGCGATAAAGGTTTGGCATGACACAGGAAAGGTGGATGCTAAGGTCGATTTTCTTCTTGATGATCAGAAGACTGACACTGAAAAATATGCCCCAG
TGGTTAACATTGAGAAGGCCTTTGAGTCACCCCATACCCATGGCAGTTGCTTCGCATATTTGCGGCAATACTCTGAGGAGTCTTTTTCAAAGGCTGCCTG
TATGGTAGCACCTAAGAGCATCATCTCCTATCCACAGGTCTGGAAAGGTCAAGGATCAAGAAAATGGAAGCTTGACCAGAGTGATGGGTTCTTTGTACAA
TTTGAATCACCAATTTTACGGAAGATATGGTTTGTTGCTAGCACAACAGAGAAGGGACGAGCATTGTGCAGGAGCCCTGAGCCCTTGGACATTACCATCC
ACGAGATCCTTCCTCGTATATTCAAAGAGAACGAAGCTACTGCTTGATATCTTTCCAAAGCAGATGCACAGTCGACGACGTCTTCTTTATTCTACTACCC
CTGACTGCGTGATCCGTATTGGCGGTTTATGGTTGAAAAGGGGGGCAGGTATTTTCTCACACAGGAAGAACTGAAATGCCATATATCTTGTAAACCGACG
ACCCTGTGTTGGTGTCGTGTACACCCAGGCACTCCAATTTTGTTGCTGTGTGGTTTTTCGCTGTATGCGGTGTATACAAGCTTTGGTGGGGTTATGCTGG
TTGCATTTCTTTGATTTGTAGAAGGAAAAGATATGTTGGAGTATAACACT
page-top