Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig79
Contig Information
Length 707 bp
Tissue Shoot with ABA treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whva6i23    rwhva6i23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays] >gi|195620128|gb|ACG31894.1| hypothetical protein [Zea mays]
Score 320
Evalue 6.09177e-28
Total Hit Count 26
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig79
ACGAGGCGACTGGTCCATCGGCTGGCTGGAGCCGCAGGCGCCGGAGATGCAGACGGACGGTGACCAGGAGACCTCCTTCGCAGTTCTCGTCCCCTGCTAC
CGCCACGGCCGCGCCGAGCAGCCCGCGATGCCCCAGGGACGGTTCCTTGGCGCTGGCCCTCTCGCCGATGGCGGCCTCTCTGATGGAAAGAATTTTGTAG
AACAGTGGCTTTCTTCCCTCCAGAACTGATATCTGGAATCTCCGTTAGCTACGCTGTATATATTATTGCTCAGTATCATTATCGATGAAGGAAGACATCA
AAACCCAAAAAAATGAGAAAATAGAAAAAGAACAAAAAGAGGAGCAGCGAATTTTGAAGCAGCACTGAACGGGTTTGTCCTTCCGGAGGTTTCAAGGCTA
ATTGTACTCATTGCAAAGCAAGGCCAATGCTGAACAAGACCAGCTGCGCTGCGCGTCGTAGAAGACACATTCATTCTTATTAACCAATCTACGACAACAT
TTGTAGATATTATTTGGTATCGCATCGTTCATTTTGTCCCACTTTGATTCTGGACCTCGACCCTGCTACTGGCATATGTATATATGGTGTCATTTGCCGT
GTATATAGAAGCTGCAGATGTGCAGCTCCTCAGTGTGCGTGTGTGTTGATGTAGATCGGAACGGGATTGCTCCTTGTGAAATTCAGATGTATATATAAGC
TTTTTGT
page-top