Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig78
Contig Information
Length 1010 bp
Tissue Shoot with ABA treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whva6i17    rwhva6i17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os10g0564100 [Oryza sativa (japonica cultivar-group)] >gi|12597881|gb|AAG60189.1|AC084763_9 hypothetical protein [Oryza sativa] >gi|78709017|gb|ABB47992.1| mediator complex subunit SOH1, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|113639940|dbj|BAF27245.1| Os10g0564100 [Oryza sativa (japonica cultivar-group)] >gi|215697352|dbj|BAG91346.1| unnamed protein product [Oryza sativa Japonica Group]
Score 701
Evalue 7.642e-72
Total Hit Count 143
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig78
GGCGCCGTCGGGGACCCGCGGGGAGCATGGATGCCATGGAGGAGGATACGCCTCCAGCGCTACCGCCACCGCCACCGCCTACGACGGGCGCGAAGCAGCC
GCCGTACAAGGATCCTGACGACGGGAGGCAGCGGTTCCTACTGGAGCTGGAGTTCATCCAGTGCCTCGCCAACCCCATCTACATCAACTATCTAGCGCAG
AATCGGTACTTTGAGGATGAGGCGTTCATCGGGTATCTCAAGTACCTCAAGTATTGGCAGCGTCCGGAGTACATCAAATACATAATGTATCCGCACTGCC
TTTTCTTTCTTGAGCTTCTCCAAAATGCAAATTTCCGAAACGCAATGGCACATCCAGCAAACAAGGAAGTTGCTCATAGGCAGCAATATTTCTTCTGGAA
AAACTACAGGAACAATAGACTGAAGCACATCCTGCCGCGTCCTCCTCCCGAACCAACTCCTGCGCCTGCACCAGCACCAGCACCAGTGCCGACGCCTCCG
CCTGTTCCTGCACCACCATCGTCTTTGCCAACTATGTCAGCTGTTGGTGCATCTGCAATGCCCCCCATGCAGTTTATAGGAACTCCTGGCGCCAACAACC
CAAAGAATGAGATGAGAAATGTTATGGGTGGTAGAAAGAGAAAGATGGGCTAGTGAAACATATTGATCAACTTCACGGCTGACGGCATCCCAGAGAAGTG
GAAACTCACCTCCCTGTTTCCTGTTGGTAGACCTTTGAAGTAGCAGACAAGTTCGAAGCAGCTCCTGCTTTGGAGCAGCTGGAGTTCTCAACGTGGCATG
CGCACTTGGCCCTTGGTTGACTTGATCATTTATCTTATCCTGGCCTTTGATGTAGTTGAATGGAATCTTTACTTGCTGAAACTTTGTGCCAACAGTGGCA
GCCGTAAAAGCGAACATTTATCACATATTCTTAGATGGAGCCGCAACATTTGCATACGCAGCTCCATGAAACGCTCCATTGCTCGTTCATATTATTTTGC
TGCACAGTTT
page-top