Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig77
Contig Information
Length 838 bp
Tissue Shoot with ABA treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whva6i15    rwhva6i15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit OSJNBa0033G16.1 [Oryza sativa (japonica cultivar-group)]
Score 86
Evalue 1.14508
Total Hit Count 13
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig77
GGAGCCTCCGCCGTCGCTCCTCCTCCCCAGCTCTCTAATCTCACCGCATCCCTCTTCTCCCTGCCCCGAGCCATCGCTGCAACCCCTCCTCCTTCCTAGG
TTTCTCCTTGACACCTCATGACTCCCCGCCACCTCTTTCTAAGCGGCGATGACCAGTGGGATTGGAGGCGGCAGCTCGCGCGGTGGGGAAAGAGGACCGT
GCTGGGAAGAAATCTCGCGGCGGCCGACGGCCAGCTCATATGGTGGGGACGGAGGTCGCCGGAGAGGAGGTGATTTGGGGGTGGCATGTCGCCCTTCGAG
CTGTGATCTGCCGTGGCTCCATTCGCATCTCCGGAGACGGTGTGTGTTGCCTTCGCTATGTATTACTCCCTCCGTTCCAATGTGGATGTATCTATACTTG
TTTAGTGTCTAAATATATTCATGTCTAGACAAATGGGAGTCAACTAATTTGGAACGGAGGGAGTACAAACGATAGGTGGTTAATTTTGCAGGAGTGCCTC
GCTTCATATTGTGCGCTTGTGTGATTTGGGGTACCGTTGGGGAGGGCTTCTTTCCTTCCATTTTTAGGTTGCTGCCTTCTGTTCTACTCCCTCTGTTCCC
AAATGTAAGTCTTTTTAGAGATTTCAACAAGGGACTATATACGGAGCAAAATAAGTGAATCTACACTTTAAAATATGTCTATATACATCTGTACGTTGTG
GTTCATTTGAAATCTCTAAAAAGACTTATATTTAGGAACGGAGGGAATATTATTGTGGTCATGTGTGTGTCGTGCTCTTTTCCAGGTTAGATCGATGGAA
CTAGCAAGGTCACACATAGAGTTGAAATCAGGGGCAAA
page-top