Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig74
Contig Information
Length 768 bp
Tissue Shoot with ABA treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whva6h23    rwhva6h23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Medicago truncatula] >gi|217075190|gb|ACJ85955.1| unknown [Medicago truncatula]
Score 777
Evalue 7.30121e-81
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig74
ACGAGGGCCTCTCCCAAACCCTCCCGCCGCCGCCGCCGCCGCCCGCCACCGAACAGCAGCCATGCCGCCCAAGCTCGACCCGTCGCAGGTGGTGGAGGTC
TACGTCCGGGTGACCGGAGGCGAGGTCGGCGCGGCGTCTTCGCTTGCCCCCAAGATCGGCCCCCTCGGTCTCTCCCCCAAGAAGATCGGTGAGGACATCG
CCAAGGAGACGGCCAAGGACTGGAAGGGCCTCCGCGTCACCGTCAAGCTCACCGTCCAGAACCGTCAGGCCAAGGTCTCCGTCGTCCCTTCCGCCGCGGC
GCTCGTCATCAAGTCCCTCAAGGAGCCCGAGAGGGACAGGAAGAAGGTGAAGAACATCAAGCACAACGGCAACATCAGCCTCGACGACGTCATCGAGATC
GCCAAGATCATGAAGCCCAGGTCCATGGCCAAGGAGATGGCCGGGACTGTCAAGGAGATCCTCGGCACCTGCGTCAGCGTCGGCTGCACCGTCGACGGGA
AGGACCCCAAGGACCTGCAGACGGAGATCGACGACGGCGAGGTCGAGATCCCCTCCGCTTAAAGGCTGATGTCGAGGTGATTATCATCTGATGATATGGA
AGTCATACCCTGTTGCAAATGTTGCCTATGTACCTCCCAAACGATGTGATCCCTCCTCTTTTTGTCATGTTTTAGCAGTAATCCTGTGAGACCTCATTGT
TACTACTGCATATTTGGTCTTTGCAATGTAGTTTGTGCACTTCAGTTAACTTAATCTATACCATTCAG
page-top