Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig72
Contig Information
Length 365 bp
Tissue Shoot with ABA treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whva4i17    rwhva4i17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative ATP-dependent DNA helicase II [Corynebacterium jeikeium K411] >gi|68264297|emb|CAI37785.1| putative ATP-dependent DNA helicase II [Corynebacterium jeikeium K411]
Score 79
Evalue 2.04903
Total Hit Count 1
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig72
TTCGGCACGAGGATTCCGGGCTACTGCGCTAATCCGTACGTGGTCATTACTCACTCCGACGGAGGCCAGGGCGCGTTTGGTTACTGGATCTGTCCGGTGG
GAGATGGTAGCGCGGGATATCTTCAACTGGTTTGGATGACGGTCATGTAATAGGATAGGCGCTTAGTTTACCTATCTCTCTTTATTATGCCAGCCGGTTG
TGGCTTTTGAGCCTTGTTTTACTTTGCTAGCTCTTTGTGAGCTAGCATCCTTTATTGCAGCACTTTGCAAGACATTGTTGAACTATTTTATTTATTTATA
AATGTGGCCGTATGCATCGTTCTGATGCAGAGGCAGGGGAATCCCCCCTTTTCGGAAAAAAAAAA
page-top