Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig71
Contig Information
Length 600 bp
Tissue Shoot with ABA treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whva4j24    rwhva4j24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_017724 [Oryza sativa (japonica cultivar-group)]
Score 375
Evalue 1.44526e-57
Total Hit Count 57
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig71
ATTCGGCACGAGGGTGGTACCCGACGGTGGAGGACGGCAGCAACAAGGGGATCGTGGTGCTGGTCACCAGCCAGAAGGAGGGCGCCATCACCGGCGGCCC
GGCCTTCGTGCAGGCCGTCGGCGACGCCATCCTCGACGCCACCGTCTCCGAGAACCTCCCAGTGCTGGCGACGGACGAGAAGTACAACGAGGCCATCTTC
TCGACGGCGAAGCGGCTGGTGGCGGCGATCGACGGGCTGCCGGACCCGGGCCGGGCCGGCGTTCCAGGAGAGCAAGCGGGAGTCCAACTTCAAGAGCAAG
GAGGAGACGGAGGAGAAGCGCGGGCAGTTCACGCTCGTCGTCGGCGGCCTGCTCGTCATCGCCTTCGTCGTGCCCATGGCGCAGTACTATGCCTACATCT
CCAAGAAGTGATCCATTCCAGCGCCGCTCAGTGTACAGTACAGCACAGTAATTTTTCGAATCCCCCCGGTTTTCTGCTCGAATTTTTAGAAGTGAACAGA
GAGAGATCAATGCAAGCGCACCCGCGCTCGTGTGCAGTGTTTGCCGCCTGTTTGGAACTAGGTAATTTACAGAGCAAACAGTTCAGTTCCAAAAAAAAAA
page-top