Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig69
Contig Information
Length 542 bp
Tissue Shoot with ABA treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whva4l01    rwhva4l01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit cadmium tolerant 1 [Miscanthus sinensis]
Score 169
Evalue 1.04621e-10
Total Hit Count 19
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig69
CACACAACCCACCCTTTGCGAAGATGTATAACGCTCCGTCGGGGCAGGAGATGTCCTACACGGACCATGTGCAGAAGCGCCACGAGGAGAAGGGCTGCAT
CTACGCATGCGTGTTCACGGCGTTGTGCTGCTTCTGCTGCTACGAGACGTGCGAGTGCTGCCTCGACTGCCTCTGCTGCTGCTGCAACTAAACCAGCCAT
GGTCACCATGGACGGACGGACGGACGGAGAAAGGTGCAGCGCGACATCGACCGGCCTCCACTACTGTTAATTATCCCAAAACCAAAATTACAATTTCGTA
ATAAGCTAGCTCTGATGAGAACTGTATCAGGTACCGCATAATATTATCTCCACCAGACAAGACTATCACTATAATCACCATCCATCATGGTTTGTGTTGC
ATCTTATTTTAATTAGCATCAGATTCTGGTCCTCACCTGCCCACTGCGCTTTTCCTTTGACACTTTGCTTTGTCTCCCTGTAATTATCTGAAGACTGAAA
TGAACATTTCATTAAATAAAATTATGTGACTGAAAAAAAAAA
page-top