Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig67
Contig Information
Length 902 bp
Tissue Shoot with ABA treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whva6g24    rwhva6g24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os03g0151900 [Oryza sativa (japonica cultivar-group)] >gi|11992279|gb|AAG42497.1|AF323991_1 small GTP-binding protein RAB5B [Oryza sativa] >gi|108706223|gb|ABF94018.1| Ras-related protein RHN1, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|113547459|dbj|BAF10902.1| Os03g0151900 [Oryza sativa (japonica cultivar-group)] >gi|215740565|dbj|BAG97221.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215768306|dbj|BAH00535.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218192105|gb|EEC74532.1| hypothetical protein OsI_10050 [Oryza sativa Indica Group]
Score 893
Evalue 3.45555e-94
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig67
ATTCGGACGAGGGACACACAGAGCCTTGGACCGGACCAACAAACGAACTGTACCCGCGACTGCGAGCGAGCGAGCGAGCGAACCGAGGAGGACAGCGCAA
CCGCCGGATCGATCCGTCCCCTCCCCGCCGATCGCCACCGTTACCCGGAGACTTCGCTCGAACCCCGGCCGAAGGCGTCGGCCCATGGGCTGCTCCTCCT
CCGTGCCAGCTAGAAGCACCGGAGGGCTGAACAATATCAACGGTAGCTCTTCTGCTGCTGATTCAAATGACTTGCGTGCCAAGTTGGTATTGCTCGGAGA
TTCTGGTGTTGGAAAAAGCTGCATCGTTCTTCGGTTTGTCCGCGGTCAGTTCGATCCAACTTCCAAGGTAACTGTTGGTGCATCATTTTTATCACAAACA
TTGGCGTTGGAGGATTCGACAATAGTGAAGTTTGAAATCTGGGATACTGCTGGACAAGAGAGATATGCTGCCTTGGCACCTCTTTACTACAGAGGAGCTG
CTGCTGCGGTTGTTGTCTATGACATAACTAGTCCAGAATCATTCAAGAAAGCACAATATTGGGTGAAGGAACTTCAAAAACATGGTAGTCCTGGTATTGT
CATGGTATTGGTTGGTAATAAAGCTGATCTACATGAAAGTCGAAGTGTACCTTCTCAGGAGGCACAAGAGTATGCAGAGAAGAACAGCATGTTATTCATG
GAGACGTCAGCAAAAACATCTGATAATATAAATCAAGTATTTGAGGAAATCGCGAAGAGGTTGCCCAAGCCAACGGCGTCCTGATAAATAAATAGCTCTC
GTGTACTATATTGAGATGGAGTGACACGCTTACAAGTCTGTACCATGTAATGCATGTAAATGCCCGAGGTTAAACTGGGCATTTGATGGAAATTGAGGAT
AA
page-top