Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig66
Contig Information
Length 760 bp
Tissue Shoot with ABA treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whva4l02    rwhva4l02   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_06649 [Oryza sativa Indica Group]
Score 784
Evalue 1.1081e-81
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig66
GCACGAGGACTTCCTCCCTCCTCTCGATTTCGATTGGAATCGGAGCCAGCTCCGCTGCCTGATTAGCCGGCCGGCCCCGGCCCCGTCTCCGTCCCCATGG
CGTCCAAGCGGATCCTCAAGGAGCTCAAGGACCTGCAGAGGGATCCCCCCACCTCCTGCAGCGCCGGCCCTGTGGCAGAAGATATGTTCCACTGGCAAGC
AACGATCATGGGCCCATCGGAAAGCCCATATGCTGGTGGTGTATTTTTGGTTACTATTCACTTCCCCCCAGACTACCCATTCAAACCACCGAAGGTTGCA
TTTAAAACAAAGGTTTTCCACCCAAATATCAACAGCAATGGGAGCATCTGCCTTGATATCTTGAAGGAACAATGGAGCCCTGCATTGACAGTTTCAAAGG
TGCTCCTTTCAATCTGCTCTCTACTAACAGACCCGAACCCCGACGACCCGTTGGTTCCGGAGATTGCACACATGTACAAGAGTGATCGTGCGAAGTATGA
GTCCACAGCGAGGAGCTGGACCCAGAAGTATGCAATGGGCTGACCTTGTGAGCCTAGGTGGAGGATGATGTTGGAGCCATCTTCGCTTGTTACACCTAAT
GTATCTTTGTTCCTGTTCTGCTGCTGCTATATGGGATTGTACTGTCCACCTACCTGACTGAATTCAAGTGTCATATTGTGAAGTGATGGCAGAAGGCCTC
TATGGGTCTATGGGTGCACCCATCCCACAAATTAATAGAGATGGGAACTGAAAAAAAAAA
page-top