Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig63
Contig Information
Length 448 bp
Tissue Shoot with ABA treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whva4m15    rwhva4m15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit F-box domain containing protein, expressed [Oryza sativa (japonica cultivar-group)] >gi|215766606|dbj|BAG98710.1| unnamed protein product [Oryza sativa Japonica Group]
Score 114
Evalue 0.000182772
Total Hit Count 7
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig63
TCGGCACGAGGCTTTGTCCCAGTGTGTCTCATATCCAAATAGTGGGGAAGCCACTGTCAGAAGATTTTGGGGTCGCTCCTAGCAAAAATGATGTAGTTCT
CAGTTACTATCTGGATTATCGTAGATTCGGGGGACGATCACAACAAAGTACTTGGCTTTGCGATGAGGATCTGGCACTTCGGTATGGCTCGAGGGATAGG
AGGACTGAACCATGAGTGTTGAGCAGGCTGCCCGGTGGGTACATAAAAGAGATGAATCAGAGGAGAAGCTTCCATACAAGTGAAGCGTATCTCGTCGAGC
TCGTGTCTATTGGTTTCGAATAAAACAAGTCCTTTGTGATCCTGTGGGAAACTGAAAATGCATTTGCTTGTGTAACTGACAAGCACAAAAGAGACGCATG
ATTGACTCGCTTCTTATAAAATCAGTGCTAATATCATTAAAAAAAAAA
page-top