Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig62
Contig Information
Length 1296 bp
Tissue Shoot with ABA treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whva5d10    rwhva5d10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0588700 [Oryza sativa (japonica cultivar-group)] >gi|113532968|dbj|BAF05351.1| Os01g0588700 [Oryza sativa (japonica cultivar-group)] >gi|215701327|dbj|BAG92751.1| unnamed protein product [Oryza sativa Japonica Group]
Score 813
Evalue 8.72036e-129
Total Hit Count 303
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig62
AGGGCGCCCCGCTCCCGAAACGACCGACCCGCTCCTCCCTCCTCTCCGGCGCGTCCAACCTAGTGCTCCGGCTACCTTTCCGGCGGCGGCGCGATGGGTG
AGCGGAAGGTGCTGAACAAGTACTACCCGCCGGACTTCGACCCGGCGAAGATCCCGCGGCGGAAGCAGCCTAAGAACCAGCAGATCAAGGTGCGCATGAT
GCTTCCCATGAGCATCCGGTGTGGCACCTGCGGCACCTACATCTACAAGGGCACCAAATTTAACTCGCGCAAGGAGGACTGCATCGGCGAGACATACTTG
GGCATACAAATATTTAGATTTTACTTCAAGTGTACTAGGTGCTCAGCTGAGATTACCTTCAAAACAGACCCTCAGAATTCAGACTACACGGTAGAATCTG
GGGCTAGTCGCAATTTTGAACCTTGGCGTGAAGAGGATGAGGTTGTGGATAAAGAGAAGAGGAAGCGAGAAGCGGAGGAGATGGGTGATGCAATGAGAGC
ACTGGAGAACAGAGCAATGGATTCAAAGCAAGACATGGACATACTTGCTGCTTTAGAAGAGATGCGGTCGATGAAGTCTAGACATGCTGGAGTCTCCGTT
GACCAGATGCTTGAAATTTTGAAGCATTCCGCTCATCAAAAGGGAGGAAAAAACAGTAGCAGAACTAGATGAAGAAGACGAAGAACTCATCAAATCAATC
ACTTTCAGAAACTCGAAAGATTATGTTAAACGGATCGAAGACGATGACGACGACAATGATGACAATTTTGGTATACCAGGACAGTCAAGTGTCACGTTAA
AGATTAATGGACCTTCTGAATCAATGACGAATCCAACAGATGTCTTGACCAAAGCTAATGGACCTGAGAGTGCCAATAAAGAAGGAAACAAGAGCTTGGC
ATCTAAGATGCCCAAATTCATAGTAAAACCAAAGCCCGCTGGTGCAAATCCTCAGAAGAAACAGAAGACGGAAACCGACGCCGTCCAAGATAACGGCAAA
GCACCGGCTGCTGAGAATAAAAAGGAAGCTTCAGTAGAGAAGACCAATGTTCTTCAGTCCCTCTGCCAGTATGATGATAGCGATGAAAGTGATGACTGAA
GACAAGACAAACCCCTGAAACACGGATGTGTTAGTCTAAGTCTGTAAATTGTCTTCTCTCGCAAAATCTCTGCTGCCAACTGTAAGTCCGCCATGTTGAA
AACCTATGGCAACTAGTAATAGTTTAGACTCCAGATAGAGTTGTGTTTGGGATAAATTTGTAACTTTAACAAATTCAGATTTTGTTTCAAAATTGA
page-top