Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig58
Contig Information
Length 686 bp
Tissue Shoot with ABA treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whva4o11    rwhva4o11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_17208 [Oryza sativa Indica Group]
Score 440
Evalue 7.01734e-42
Total Hit Count 444
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig58
CGAGGGAGCCATGGAAGGGGGGAGCCTCTGGCACGAGTTCGAGACGGACCTCCCGGCCGCTGACGTGTGGGAGGTCTATGGCAGCCTCGCTCTCGGGCAA
CTAGTCCCCCAGTTGCTCCCACAGGTCCTCTCAAAGGTCGAGCTTGTAGAGGGAGACGGCGGCGCCGGAACAGTCCTGCTCGTCACTTTCCCTCCTGCAG
GAGCTTCCGAACCAAGAAGCTACAAGGAGAAGTTCAACGTAGTCGACGATGAGAAGTACATCAAGGAGGCAGAAACGGTGGAGGGAGGCTTTCTGGATCT
CGGCTTCCGGAAATATGTGGTGCGATTCGAGGTCGTTGGGAAGGAAGATGGCACGTCGGTTATAAGATCGACCGTCGAGTATGAGGTTGATGCCGAGCAT
GCCAAGAATGCCTCCCTTGTCAGCACAGAAGCAGTGGCCTCTATTGCTGAGGCCATCACCAAGCACATCAAGGAGCAGAAGAAGAGCCCCGAGCAAACCC
CCGAGTAAAATTCAGAAGAACTTGCATGTGCCTGGATAAGAGTCGGGAAGACGAAGTGTCCAACTGAAGTGACTGTGGCAGCCAAGTTGGAGCAAATTCC
CCTGTACCATTTTGTTCTATATATGCAGTGCTCATGCCTTTGGAATTGATGTTTGTATGTTTTAGATTATACACTANTTTCTACCA
page-top