Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig57
Contig Information
Length 776 bp
Tissue Shoot with ABA treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whva6f20    rwhva6f20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os12g0178100 [Oryza sativa (japonica cultivar-group)] >gi|88909670|sp|P0C0L1|APX6_ORYSJ RecName: Full=Probable L-ascorbate peroxidase 6, chloroplastic; AltName: Full=OsAPx06; Flags: Precursor >gi|77553821|gb|ABA96617.1| L-ascorbate peroxidase 6, chloroplast precursor, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|113648812|dbj|BAF29324.1| Os12g0178100 [Oryza sativa (japonica cultivar-group)] >gi|125535967|gb|EAY82455.1| hypothetical protein OsI_37672 [Oryza sativa Indica Group] >gi|215686471|dbj|BAG87732.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215708725|dbj|BAG93994.1| unnamed protein product [Oryza sativa Japonica Group]
Score 925
Evalue 5.15561e-98
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig57
CTTATGCGGATCTGTTTCAGCTTGGCCAGTGCTACAGCCGTTGAGGAAGCCGGTGGCCCCAAAATCCCCATGATCTATGGAAGGGTTGATGTTTCTGCCC
CTGAACAGTGCCCACCAGAGGGGAGACTCCCTGCTGCTGGTCCGCCTTCACCTGCTGAACATTTGCGAGAAGTATTCTACAGAATGGGCCTGAATGACAA
GGAAATTGTTGCATTGTCAGGAGCACACACACTTGGACGATCAAGACCAGAGCGCAGCGGCTGGGGTAAACCTGAAACAAAATACACTAAAAATGGACCT
GGTGCACCTGGGGGTCAATCTTGGACATCACAGTGGCTCAAGTTTGATAACAGCTATTTCAAGCATGTCAAAGAACGACGAGACGAGGACCTTCTAGTTC
TGCCCACTGATGCTGTGCTCTTTGAGGATCCATCATTCAAGATTTATGCCGAAAAGTATGCTGAGGATCAGGATACATTTTTTGAAGACTACGCTGAAGC
TCATGCTAAATTGAGCAATCTTGGGTCTAAGTTTGACCCTCCTAAGGGTGTATCACTAGACTAGCTGATATTTGCTGCTGATGAACTGCATTTTGGTGAG
TGAAGATGACAAGGCTATGTTTCTTGCAACTATTTTCGAGGTGAACAAATTCGGATCCACCGAAGCAGTATTTTGAGTTGTGTGCTCTATTACCAGAAAT
AAAAGCAGCATTGGACAGTTCCCGGACCGAACATTTATGATACTTGCATGTTGTATGACACTTCAAGGTACAAATA
page-top