Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig55
Contig Information
Length 1207 bp
Tissue Shoot with ABA treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whva4o15    rwhva4o15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit DEAD box RNA helicase1 [Zea mays] >gi|39653663|gb|AAR29370.1| DEAD box RNA helicase [Zea mays]
Score 232
Evalue 2.40493e-17
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig55
TTCGGCACGAGGGACAAGTTAAAACTCTCTCCATGGAGCACTGTGACTGCCCTTATTGGTGTAAAGCAATAAAAGCGCTCACACAGTGTGACTTGCATAG
GTAATTAAGATAATTTGTTCATTCTTATAGAACTGTAAGGATCTCCCTGCCCCCTACACTTATTACCTGCTTAATAAGTGCCTCGTCTGTTGGTATCACT
GCCAATTGGTATAAAGATGGTTTGTAGTATTGTCATTGAAATCCTCAAGTTGACCTCTGATGAAGCACCTAAGCATTGCGGCCTTTGTTGGATTGGTGTG
GATGACAGATTTGTTCTGGTTCACACGGATATATGTTGGTGTTGGTACATTATATTGGATATAAAAGTCACCCTTTGTAAAAAAAGGCTTGAGTTTAAGC
ACCATCAATTCCACATCCAGCAGTGATTGATACCCAGTTCAGTTCTGCAGCCCCTTCGACTTGTGTTAGCTGTAGATGTTGAAAGTGAAGCCTTGTGCAG
TGTTCTTTGGATCTTGTCTAAGCCATGTGCTACCTTTCTGTGGAGATCGACAATGTTGATGCCCAGTGTGGTCCGCAGTGGTATTCAGGAATCAGGACTA
CACATTTATCTTGTTTGTATACTGATGATGGTCTTGTTGACTTTGCAGATGTGAAGGATATTAAGTGCGTGATTAATTTTGATTTCCCGACAACTATCGA
GGATTATATTCACAGGATAGGCCGAACTGGCCGTGCTGGTGCTACCGGGATGGCATTTACGTTCTTCACACATTCCAATGCAAAATATTCAAGGAATCTC
GTTAAGATCTTGCGCGAAGCTGGGCAGGTTGTGAATCCAGCGCTAGAAGCTATGTCCAAGTCCTCTGGTTCTATGGGAGGAGGAGGCAATTTCCGGTCAA
GAGGCCGAGGTGGGTTTGGTGGTGGGTATGGTGGTAACCGTTCTGGATCAAATTCCATTCCAGTACGTAGAAGATACTAAGAAACGAAAATGAAGATCCA
TTTTGATGCTGGAAAAGACGGAACGATGAAGTTTTATCTGTATACATTAGGCATTAAATTAAATGCATTTTTGGGGAATTTCTTTGAAATCCTGCTACTG
TTAGAGATCAAAACAAAAGTCATTCTTAATATTTTTGTACCGGAGCTCATATGAAAGAATCTCATGTATCAGCGACCTTGGAGATTACAGTAGTTCTATC
GAAACAG
page-top