Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig54
Contig Information
Length 425 bp
Tissue Shoot with ABA treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whva6f05    rwhva6f05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Zea mays] >gi|195610634|gb|ACG27147.1| hypothetical protein [Zea mays] >gi|195656031|gb|ACG47483.1| hypothetical protein [Zea mays]
Score 156
Evalue 2.45959e-09
Total Hit Count 35
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig54
CCAAGATCCATATCTGCGGCCGTGAGATCAGATCAGATCAGATCGACCGAAGTCCAAGGCAAGAAGGAGAAGCGGCGGAGGATGGCGGACTGGGCACCGG
TGGTGGTGGGGGTGGTGCTGTTCGTGCTGCTCTCGCCGGGGCTGCTGTTCGAGATGCCGGGGTCGCACCGCCACGTCGACTTCGGCGGCCTCCACACCAA
CGGCAAGGCCATCTTCGTCCACACCCTCCTCTTCTTCGCCGCCTTCACCATCCTCACCCTCGCCCTCCACATCCACATCTACGCCGGCTAGACTGACACC
CCATACCCCATAGATGCGCCATGTACTACCAATACTACTAGCTAGCTCTTGCCTGTCCGCGTGCTGTTCTCTTGCTCGGTAAATCGATCCCCTCCATGTA
ATCAATCTGCTTGTAATCCAATCCC
page-top