Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig52
Contig Information
Length 735 bp
Tissue Shoot with ABA treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whva5b05    rwhva5b05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_029213 [Oryza sativa (japonica cultivar-group)]
Score 883
Evalue 3.44514e-93
Total Hit Count 309
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig52
GAGGCTCAACTGGTACGCACAGGTGTTGCTGGATCATGCGGACCGCGTGCTGATGCTAGCCAGGTTGGCCTTTGAAGGCTCAGCTATTGCTGTCAAGGTG
TCAGGCATACACTGGTGGTACAAAACTGCCAGTCATGCTGCTGAGCTGACTGCTGGGTTCTACAACCCATGTAACCGCGATGGCTATGCTCCAATTGCCC
AAGTATTGAAAAAGCATGGTGCGGCTTTGAACTTCACATGCGTCGAACTGCGCACCATGGATCAGCATGAGGTGTACCCCGAGGCCTTGGCAGATCCAGA
GGGCTTGGTATGGCAGGTGCTGAACGCTGCGTGGGATGCCGGGATACAAGTGGCCAGCGAGAACGCGCTGCCATGCTACGACAGGGACGGCTTCAACAAG
ACACTGGAGAACGCCAAGCCGCGGAACGACCCCGATGGGCGGCACTTGTTCGGGTTCACCTACCTGAGGCTTTGCAGCACCCTCTTCGAGGGACCCAACC
TCCCTGAGTTTGAGCGTTTCGTCAAGAGGATGCACGGCGAAGCGGTTCATGACTTGAGGGCGTAGATTGTTAGCGTGTTACATACATAAGTACATAATAC
ACAAGACTTTTTTGTTGTCCCAGGGGCTCATTATGGTTCTCATTGCGGAACCACATGTGCCATTTTTGTCTCGCGATAGCTTGATATTTGAGCTATATAT
TGAACCGAATAACGCCGCTCCAAGATGTAAACCAT
page-top