Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig50
Contig Information
Length 676 bp
Tissue Shoot with ABA treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whva6d24    rwhva6d24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_029091 [Oryza sativa (japonica cultivar-group)]
Score 534
Evalue 8.47523e-53
Total Hit Count 83
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig50
GCGACGACTCGCCGGAGAAGATTCCCGTCGGGAAATCAATCCATCGGAGGAGCTCCACGATGGCGGGGGAGGGAAGGCCGGACGCGCAGCTCTTCCAGCT
CCTCACCGACCTTCTGCAGGAGGTGGAGTCAATGAGCAACCAGGAAGAGGTAGAATTGAGAGCAAAGATTGAAGCGCTGGGCCTAGAAGTCACTAAGGTT
CCAGAGAAGGCACCTAAGCAACTTGATGAGTTAGAAATAGCTGCAGAGCTGGACAGGCTGTCGGCAAGGCTCGATAATGTCGACAAGATGATATCATCTG
CCATGACATCTGACCCCGAGGTGAAATCGCTTCTGAGCAGCACCGCCGATGTCTGGATGCCCGTCATCACCGCGTCTGCTGATGAAAGGCGAGGGTTTGC
GGAAACAAGTGGCAACAAGGGAGAGCAAGAGAAATCTAAGTAAATAGCTTGGACTGAAGCCCTTGTAGTCCTTTGTGCCAGCCTTGTTCTACATGTTTCT
TACATGAGTATATGTCCATAGCTATGTATCAAATGTTCTTTTTTGGGGGCATAACAGAAAATAATCACACATGTTGTTCATGTACTATAATAACTAATTT
GTCGGATGGTTTGAGGTAATAAAGTCTGCCAAGTACTGTAGGGGCTTCCCTTATAGTCTTTTTGTCAAAAAAAAAA
page-top