Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig49
Contig Information
Length 267 bp
Tissue Shoot with ABA treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whva5b15    rwhva5b15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit tropinone reductase 2 [Zea mays] (no hit)
Score 487
Evalue 2.41384e-47
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig49
CACCGCTGCCGCCACCGCCACCGCCAACGTCTGATCGTTCCATCATGGGCCGGACATGCACATGTCAATTCATCATCACTATATTGCAAGTAGTATATAT
ATACTTGCCATGACTATACTAGTTAGTTACGATCGAGTTACCCTATCTTAGAAAATGGAGTAGCCTTAATGGAATTTTCGAGCATCAAATAATCTTATGG
TAAATTATTGTCTGCCAATAATAAAAATAAGATAAAGAGCACTAGTTAAAGTGGGATAAAAAAAAAA
page-top