Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig47
Contig Information
Length 363 bp
Tissue Shoot with ABA treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whva5b20    rwhva5b20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=High molecular mass early light-inducible protein HV58, chloroplastic; Short=ELIP; Flags: Precursor >gi|19025|emb|CAA33728.1| unnamed protein product [Hordeum vulgare subsp. vulgare]
Score 282
Evalue 5.94353e-24
Total Hit Count 260
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig47
TCGGCACGAGGCCATGGTGGGCTTCGTGGCGGCGCTCTCCGTCGAGGCGGCACGCGGGGGTGTTCTCCGCGGCATCGTTGGTGCCGCTACTGCAGGGCCA
GACTGTCGAGAGCAAGTCGAGCGGAATCTGGAGCGCCGACGCAGAGCTCTGGAACGGCCGCTTCGCTATGCTCGGCCTCGTCGCGCTCGCCGCCACCGAG
TTCATTACCGGCGCTCCCTTCGTCAACATCTAAGACTATGTACTGTAGCGCTGCGGATTCTCTTTTCATCAGCTAACAAAATTGTAATAGTAGTAGTACT
AACTGTTGTAGCCACGTTTATGTAAAAAAAAAAATTGCAGCCACGTTTATGCCAAAAAAAAAA
page-top