Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig46
Contig Information
Length 1133 bp
Tissue Shoot with ABA treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whva6d03    rwhva6d03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein LOC100216779 [Zea mays] >gi|194696508|gb|ACF82338.1| unknown [Zea mays]
Score 397
Evalue 5.67981e-42
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig46
CGAGGCCTCGTGCCGCGCCTACCGCGACCAACCTGACCGGCCAGCCGCCCCGCCGTCGTCGCCTCTGCCGCCGCGATTTGTCCGGCGGGATCGCACGAGG
AAGAAAGGGAGAGAGATGAGGAGCAGCGAGGCCATGGAGCTCCTGGGCTTCGCTCCCTACTCCCGCCCGTCCCCTTCCGAGGTTAAGGCTGCGTATAGAA
GAATGGTCATGGAGTCCCATCCCGATCGCGTCCCGATGGATCAGAAGCCTCAAGCCGAGTCAAAATTCAAGCAGGTAGTAGAAGCATATTCTTGTTTGAA
GGATGGTCGAAGATTTGGGAACAGAATGGAAGTACATGTAATGAGGTCTGGTGTTCCAACGGGATACAGAAGATCAAACAAGATATTGGAGAAAAACATC
AAGATCTACATTCTTATTGCTGATTGAGAAATCCATTTTGGTTTCATGAAGGGCATACCAGCGGCAAAAGGATGTGTGTTCCTCTCAGAACCCTTTTCTT
CCATAATGGAAACTCATTGTACTGTCGATATCCATATAAGCTAATAGAAGAGAAGATCTGTGTGTTGCAATTTGAGATGCAAAACAATCTCTCCACTGAA
TAAAGGCACCAATCACTGTTTGTGATTTCAAAGAAAAGACACATGCTTTGTAGATGTTCAGTTTAGCTCTAGGGAGCATATGCTCCTGCGCGCCGCTTCC
CTGAACGTTTTGTCCAGTGGACAAAAGATGTCGTTAGTAATGGAAAGGTTGCCATCACTATTAATGATGTTATTGGCCCGTATTTTGTTACCAGGAAGGG
TTTGAGGCAAGGGGATCCGTTTTCCCCCTTGCTTTTCAATTTGGCGGCTGATGTTCTTGCTACCCTGGTGCAAAGGGCGCAAGAACAAGGATTTATCAAG
GGAGTGTTGCCTAGGTTGTATTCAGGAGGTCTAAATATTTTGCAATATGCGGACGATACTATTTTCTGTTTTGAAGATGACCTTGAGGGGGCTAGGAACC
TCAAAATTGTTAGAGTTATAATATAAGTCATGAACCCCTTTGTATTTATCCCGTTGTATAAGGGGTTTCCTGCATATGTTCCACACCTGTACATGTATAT
ATATATCGGCCTATGGCCTCATGGGAATACAAG
page-top