Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig45
Contig Information
Length 663 bp
Tissue Shoot with ABA treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whva5c08    rwhva5c08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit senescence-associated protein DIN1 [Zea mays]
Score 387
Evalue 9.11358e-36
Total Hit Count 396
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig45
GCCCCTTCTTCCTAGCTGCTCAATCCTCCATAGATGGGCTCCCTGCGAAGCAGCACGAGCACGACGGTTGAGAGCGTGGACGCAGATGCAGCGTGCGGGC
TGCTGGCCTCGGAGCAGTACGGGTACGTGGACGTGCGGATGTGGGAGGACTTCGAAAAGGGCCACGTTGCCGGTGCACGAAACGTGCCCTACTACCTCTC
TGTCACGCCCCATGGCAAGGAGCGCAACCCGGACTTCGTCGACCAGGTTGCGGCGCTCCACTCCAAGGAGGACCGGTTCCTTGTTGGCTGCCGCTCTGGG
GTCCGGTCCAGGCTCGCCACCGCAGACCTCGCCGCCGCTGGGTTCGCGAACGTGAAGAACCTGGAAGGCGGTTACCTCTCCTTGCTCAAGAGTACCAGTT
ACCCGCAGCCGCAAGCAGCAAGCCACCAATGATCCATCAATTGATTCTTGTGAGTTTGGAAAAAGTCCGTTAGTGACCTGTTTGTGTACTGTGTTTCTAT
CGTCCTTCGTCTTCTGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGCAAGTCCTTCAGCTGAGGCGGACAGCTGAGATTTATTAATATCAAAGGGAAAAC
AAAGCCGTATGTATGTAGGTACGTATATTGGACTTGGACTTTGGACCAACCAATCCCAAGAAA
page-top