Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig43
Contig Information
Length 898 bp
Tissue Shoot with ABA treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whva6c21    rwhva6c21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit metallothioneine type2 [Hordeum vulgare subsp. vulgare]
Score 149
Evalue 6.38239e-08
Total Hit Count 6
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig43
ACGAGGGAAGCACACAGGAAGCTCCTAGCCAACACCAAATCAAGGCCTCCATCCAAGCCCAAGCAACCTCGAATATGTCTTGCTGCGGAGGAAACTGCGG
ATGCGGCACCGCCTGCAAGTGCGGCAACGGCTGCGGTGGCTGCAACATGTACCCCGAGGTTGAGGCCGCCGGCGCCACCCTCCTCGTCTCCGCCACTGCC
ACTCACAAGGGGAGCTCCGGCGGCATGGAGATGGCGGCCGAGAACGGCGGCTGCGGCTGCACCCAGTGCAAGTGCGGCACCAGCTGCGGCTGCTCCTGCT
GCAGCTGCTAGATCATTGATCATGCATGCGCCGCGTGCATCATATCTATGATCTACGTATCCATCTACTACCATGTAATGCCACCTGATCGAGGGTCTTT
GTATGTATGTAGTATGTACGCACCTGCCTGCATGAGCAGAGCGGGTGCCATTCCATGCATGTAAACCCCTAAATAAAATCTCCCGTGGTTTTGCTTACAT
CGTGTTGTTAGATCCTCCTCCTATTAGTGTTGCTTTCGGGTTCTTCTTATGCACTAGCAGGATCAGAGGCCGGTCTTTTGTTCTTGGTCTTCTCCTCAAA
CTGTCGTTTTCCTCTTCTCTATGGTTCCATGTGCGGCAGTATTTTCTTCTTCTGTTGCCGAGTGTTGTATCAGACTGTACCTTGTTTTGTGGTTTATTCC
TATCCATCTCGAAATATAGTGCAGGAATTTATTTGCAAAAGGTGGATCTCAACAAGACACGACGGTATGTGTATCTTGCAGGATTTATTGATCGGTCTAT
CTTATGCGTCTTATTAAAAAAATACATTAAGGTCTCATGGTCAAGCCAAATTATCATTGTTTTTCCTTGCATGCAAAATGCAGCAATAAATCTTCGTC
page-top