Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_VABA_all.Contig41
Contig Information
Length 1001 bp
Tissue Shoot with ABA treatment
Clones 2 Clones [Download: CSV  ,  FASTA ]
whva6c16    rwhva6c16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit UCW116, putative lipase [Hordeum vulgare subsp. vulgare]
Score 834
Evalue 5.27908e-140
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_VABA_all.Contig41
GGGCGCCAACATGGCCATCACCGGCGCCACCGCCATGGACGCCCCCTTCTTCCGCTCCCTCGGCCTCTCCGACAAGATCTGGAACAACGGGCCCATCAGC
TTCCAGCTCCAGTGGTTCCAGACCATCACCTCCTCCGTCTGCGGCAGCAGCTGCAAGAGCTACCTGGCGAACTCGCTCTTCATCTTCGGGGAGTTCGGGG
GGAACGACTACAACGCGATGCTGTTCGGCAACTACAACACGGACCAGGCGAGCACGTACGCGCCGCAGATCGTGGACACCATCGGCGCCGGCGTGGAGAA
GCTGGTCGCGATGGGGGCGGTGGACGTGGTGGTGCCCGGGGTGCTCCCCATCGGCTGCTTCCCCATCTACCTCACCATCTACGGCACCTCCAGCGCCGCC
GACTACGACGCCCTCGGCTGCCTCAAGAAGTTCAACGACCTCTCCACGTACCACAACAGCCTGCTGCAGGCCAAGGTCACGAGCCTCCAAGGCCAAGTAC
AAGTCGGCGCGCATCATGTACGCTGACTTCTACGCCGGCGTCTACGACATGGTCCGGAGCCCCAGCAAAATACGGGTTCAGCTCGGTGTTCGAGGCGTGC
TGCGGGTCGGGGGGAGGCAAGTACAACTACGCCAACAGCGCGCGGTGCGGCATGTCGGGCGCCTCCGCCTGCGCCAGCCCGGCGTCGCACCTCAGCTGGG
ACGGCATCCACCTCACCGAGGCCGCGTACAAGCAGATCACCGACGGATGGCTCAACGGCGCCTTCTGCCACCCCGGCATCTCCCACTAGCCAGCCACTCC
CGCTGGCCGATCAACCAGCTCATGCATCGTCGTCCATGGATCCATCATTAATCAATCAATCAATCAATTATTATTATTATTATTTGTTCAGTCGGGTTAA
TTATTATAAGGAAACGTTTCTGGGGACTGGCTAAGGCTGGGTTCCCGGTCTGATCTGGGCGCGTGTGTGCTGATGAAGAAAGGGGAAAGAATGACGGCAA
C
page-top